Ressources

Ressource: HAPT LUC insertion aléatoire 384

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 384

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta12g00340

Voir cette cible sur JBrowse
Lien :
Séquence début :
acgcagacgggatacatcggtgggttcgtcgatcgaccgaggtactttgat
Chromosome : 12
Position de début : 48780
Position de fin : 48830
Voir sur JBrowse
Séquence transgene :
aagccatgggaattcactggccgtcgttttacaacgtcgtgactgggaaaa
Chromosome : 12
Position de début : 52
Position de fin : 102
Voir sur JBrowse

Commander