Ressources

Ressource: HAPT LUC insertion aléatoire 381

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 381

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta11g00160

Voir cette cible sur JBrowse
Lien :
Séquence début :
ctctcccagctcgtcgtcaatgattcctatgtcgtcatcgtctgagtcgtc
Chromosome : 11
Position de début : 27657
Position de fin : 27707
Voir sur JBrowse
Séquence transgene :
ggataacaatttcacacaggaaacagctatgaccatgattacgccaagctt
Chromosome : 11
Position de début : 3708
Position de fin : 3758
Voir sur JBrowse

Commander