Ressources

Ressource: HAPT LUC insertion aléatoire 379

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 379

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta09g04150

Voir cette cible sur JBrowse
Lien :
Séquence début :
gaccggtgttgcgaagaagatcgcggaggcgacgcgggcgatgaacgacgggttggtggagcgagagacggagacgaggctgttgctcttagccgcgtgctgcggtgagcatctgttgctcatcggaccgccggggacggcgaagagcgaactggggagacgattgtccgctctgtgcgagagtgggtcgtatttcgaacgcttgctcacgaggttctccgtgccggaggagttgttcgggccgctgagcatgaaggggttggagagggatgagtacgtgcgaagaatcgatgggtacctccccacggcgagcgtggcgttcgtggacgaagtgttcaagg
Chromosome : 9
Position de début : 624483
Position de fin : 624823
Voir sur JBrowse
Séquence transgene :
ggcacacaatgagtcatgaaccacaatgcgtggatttaaaaacaatcaagtgatgcatgcacgtgaaaaatgggcatttcaagtaaatagagagtaatgactcgtgtatgaccccctgctttcaaactcaccga
Chromosome : 9
Position de début : 3286
Position de fin : 3419
Voir sur JBrowse

Commander