Ressources

Ressource: HAPT LUC insertion aléatoire 377

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 377

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta09g03510

Voir cette cible sur JBrowse
Lien :
Séquence début :
cacgtggcgtcggttggggagacgacgcgcgtttgggcgcggacgcggatg
Chromosome : 9
Position de début : 519592
Position de fin : 519642
Voir sur JBrowse
Séquence transgene :
gtcgtgactcgcacggagtattttcaactcaccgcgaactcaccggcgccc
Chromosome : 9
Position de début : 3170
Position de fin : 3220
Voir sur JBrowse

Commander