Ressources

Ressource: HAPT LUC insertion aléatoire 372

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 372

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta09g04150

Voir cette cible sur JBrowse
Lien :
Séquence début :
tctgaggcaccgtcactttagccgcggcttcgtgacgaatgttggagaaatcctccggcttgagcgtcacggagacgctcgaattcatgccgccgcgatcgcccgccttggaaccgatcgcggcgtcaccgctgagcgcgagaagcttggacaacccccctgatgacacttgttccacgctcgatcgcaataaaaaccgatcgtacagcgcgtccagctcctcgctctctggcaactcgttggacgcccccaccatgcacagcagcgggacgtcgatgcgttcgctcccgttatcgaacaaccgttcg
Chromosome : 9
Position de début : 624135
Position de fin : 624442
Voir sur JBrowse
Séquence transgene :
ggagtacggataaaatgcttgatggtcggaagaggcataaattccgtcagc
Chromosome : 9
Position de début : 2840
Position de fin : 2890
Voir sur JBrowse

Commander