Ressources

Ressource: HAPT LUC insertion aléatoire 336

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 336

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta10g03500

Voir cette cible sur JBrowse
Lien :
Séquence début :
cacgtcgacatcgttttcgtcgtctctgacaaagatgaagaaatcacccga
Chromosome : 10
Position de début : 564246
Position de fin : 564296
Voir sur JBrowse
Séquence transgene :
cgccaccaaggcggcccgcaagtccgccccggcgaccggcggcgtcaagaa
Chromosome : 10
Position de début : 3548
Position de fin : 3598
Voir sur JBrowse

Commander