Ressources

Ressource: HAPT LUC insertion aléatoire 330

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 330

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta05g04260

Voir cette cible sur JBrowse
Lien :
Séquence début :
gcggaatcctgctcgtagctcacatccacggcgacgcgcagcgcgttcgga
Chromosome : 5
Position de début : 692504
Position de fin : 692554
Voir sur JBrowse
Séquence transgene :
catgcgtcaatcgtatgtgaatgctggtcgctatactgctgtcgattcgat
Chromosome : 5
Position de début : 2077
Position de fin : 2127
Voir sur JBrowse

Commander