Ressources

Ressource: HAPT LUC insertion aléatoire 317

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 317

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta02g03470

Voir cette cible sur JBrowse
Lien :
Séquence début :
ccgcgcgatggcacgaacgtggacattaactctatatccagtcgcgagcgt
Chromosome : 2
Position de début : 710623
Position de fin : 710673
Voir sur JBrowse
Séquence transgene :
gcgcggggccttgcccccggtggacttacgggcagtttgctttgtacgggc
Chromosome : 2
Position de début : 3489
Position de fin : 3539
Voir sur JBrowse

Commander