Ressources

Ressource: HAPT LUC insertion aléatoire 313

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 313

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta14g00070

Voir cette cible sur JBrowse
Lien :
Séquence début :
aaatagccgccgtgtgtaagcgctctttcgacgtcaaggacatcgtacggg
Chromosome : 14
Position de début : 12415
Position de fin : 12465
Voir sur JBrowse
Séquence transgene :
ctcgtgtatgaccccctgctttcaaactcaccgactcaccggcgcgcgcgg
Chromosome : 14
Position de début : 3386
Position de fin : 3436
Voir sur JBrowse

Commander