Ressources

Ressource: HAPT LUC insertion aléatoire 308

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 308

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta09g04300

Voir cette cible sur JBrowse
Lien :
Séquence début :
gttcgcgcttcagctccctctcgtgctctccgtcgccggtccacgcgcgg
Chromosome : 9
Position de début : 649951
Position de fin : 650000
Voir sur JBrowse
Séquence transgene :
gatcgcacggcgtcgtcacaactcgacagtcaatatggcccgtacaaagca
Chromosome : 9
Position de début : 3452
Position de fin : 3502
Voir sur JBrowse

Commander