Ressources

Ressource: HAPT LUC insertion aléatoire 275

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 275

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta04g03530

Voir cette cible sur JBrowse
Lien :
Séquence début :
ccacgcagggcactttgtcgcgcctcagagacgactactcgcgcgcgctag
Chromosome : 4
Position de début : 572625
Position de fin : 572675
Voir sur JBrowse
Séquence transgene :
taatttcatgggtcgtgactcgcacggagtattttcaactcaccgcgaact
Chromosome : 4
Position de début : 3181
Position de fin : 3231
Voir sur JBrowse

Commander