Ressources

Ressource: HAPT LUC insertion aléatoire 274

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 274

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta04g01920

Voir cette cible sur JBrowse
Lien :
Séquence début :
agctcgttgaatccgccaggagactgtccacgcaaattgcgcaacgaacat
Chromosome : 4
Position de début : 297841
Position de fin : 297891
Voir sur JBrowse
Séquence transgene :
cagtttgctttgtacgggccatattgactgtcgagttgtgacgacgccgtg
Chromosome : 4
Position de début : 3457
Position de fin : 3507
Voir sur JBrowse

Commander