Ressources

Ressource: HAPT LUC insertion aléatoire 273

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 273

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta03g03550

Voir cette cible sur JBrowse
Lien :
Séquence début :
ccagggcttgcatgagagctctgactccatctggtccgatggagttgaaac
Chromosome : 3
Position de début : 573610
Position de fin : 573660
Voir sur JBrowse
Séquence transgene :
tcttccatggaaagcttcctagggcggccgcttaattaaactagtacgcgtc
Chromosome : 3
Position de début : 231
Position de fin : 282
Voir sur JBrowse

Commander