Ressources

Ressource: HAPT LUC insertion aléatoire 236

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 236

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta11g01590

Voir cette cible sur JBrowse
Lien :
Séquence début :
atcgaaatcgctcacgacttcttgatgactttgttgcgggcatcgctgagc
Chromosome : 11
Position de début : 295875
Position de fin : 295925
Voir sur JBrowse
Séquence transgene :
atggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccaca
Chromosome : 11
Position de début : 3723
Position de fin : 3773
Voir sur JBrowse

Commander