Ressources

Ressource: HAPT LUC insertion aléatoire 234

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 234

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta09g00090

Voir cette cible sur JBrowse
Lien :
Séquence début :
agttgtgggagatgtgcacgggaccgaggaatccctcgggcgtgagcggcg
Chromosome : 9
Position de début : 17399
Position de fin : 17449
Voir sur JBrowse
Séquence transgene :
ccgcccgggtaccgttgcgctcgtgggatctttcacctcttagtcttctg
Chromosome : 9
Position de début : 3611
Position de fin : 3660
Voir sur JBrowse

Commander