Ressources

Ressource: HAPT LUC insertion aléatoire 233

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 233

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta09g02310

Voir cette cible sur JBrowse
Lien :
Séquence début :
atccttgaacgtggtcttcgtgtcgtaaggccccgccgcggtgagcaagg
Chromosome : 9
Position de début : 348498
Position de fin : 348547
Voir sur JBrowse
Séquence transgene :
aactagtacgcgtcttaagcgagacgggtaaagcgcgacgtgaagtaacgc
Chromosome : 9
Position de début : 194
Position de fin : 244
Voir sur JBrowse

Commander