Ressources

Ressource: HAPT LUC insertion aléatoire 232

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 232

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta08g04140

Voir cette cible sur JBrowse
Lien :
Séquence début :
gccaaggcggtggctgcagcgcgtgagaaggaacaaaaggagaaagccgcg
Chromosome : 8
Position de début : 662674
Position de fin : 662724
Voir sur JBrowse
Séquence transgene :
aagccgcacaggtaccgcccgggtaccgttgcgctcgtgggatctttcac
Chromosome : 8
Position de début : 3597
Position de fin : 3646
Voir sur JBrowse

Commander