Ressources

Ressource: HAPT LUC insertion aléatoire 231

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 231

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta08g01410

Voir cette cible sur JBrowse
Lien :
Séquence début :
agtttgctgagctgaagtactggtcgtagttcactggtgtcgcgacaatct
Chromosome : 8
Position de début : 240818
Position de fin : 240868
Voir sur JBrowse
Séquence transgene :
agttccataggatggcaagatcctggtatcggtctgcgattccgactcgtc
Chromosome : 8
Position de début : 2409
Position de fin : 2459
Voir sur JBrowse

Commander