Ressources

Ressource: HAPT LUC insertion aléatoire 229

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 229

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta08g01280

Voir cette cible sur JBrowse
Lien :
Séquence début :
cggccgcttggcgaaggtgcgattccttgctgagcaaaccaatcatcggct
Chromosome : 8
Position de début : 205161
Position de fin : 205211
Voir sur JBrowse
Séquence transgene :
tcaataccatatttttgaaaaagccgtttctgtaatgaaggagaaaactca
Chromosome : 8
Position de début : 2351
Position de fin : 2401
Voir sur JBrowse

Commander