Ressources

Ressource: HAPT LUC insertion aléatoire 196

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 196

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta04g01380

Voir cette cible sur JBrowse
Lien :
Séquence début :
acgaatcgcacgacccggtacacttggtggcgtcatcgctcgcggacgctc
Chromosome : 4
Position de début : 547867
Position de fin : 547917
Voir sur JBrowse
Séquence transgene :
ctgcgcgcgcggtcggggccacggacgcgggcgccggtgagttcgcggtga
Chromosome : 4
Position de début : 3142
Position de fin : 3192
Voir sur JBrowse

Commander