Ressources

Ressource: HAPT LUC insertion aléatoire 192

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 192

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta02g01030

Voir cette cible sur JBrowse
Lien :
Séquence début :
ttgtcgcctagttcagttgcaatagacttgagtgctgtcatggcattgtct
Chromosome : 2
Position de début : 263325
Position de fin : 263375
Voir sur JBrowse
Séquence transgene :
atatttcacgttcttgcggcctggcgacgctgacggcgttacttcacgtcg
Chromosome : 2
Position de début : 159
Position de fin : 209
Voir sur JBrowse

Commander