Ressources

Ressource: HAPT LUC insertion aléatoire 188

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 188

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta01g06270

Voir cette cible sur JBrowse
Lien :
Séquence début :
cccgtgcgttcgcccgacaaaaaccttcggttccgcgtcatcgggccccgt
Chromosome : 1
Position de début : 1006092
Position de fin : 1006142
Voir sur JBrowse
Séquence transgene :
ttaagccatgggaattcactggccgtcgttttacaacgtcgtgactgggaa
Chromosome : 1
Position de début : 54
Position de fin : 104
Voir sur JBrowse

Commander