Ressources

Ressource: HAPT LUC insertion aléatoire 180

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 180

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta01g06270

Voir cette cible sur JBrowse
Lien :
Séquence début :
gcgatgcgcgtgacgttcgtcaccgggaacgcgaaaaagttggaggaagtgcgagcgatcttaggcgccgggtcgacgatcg
Chromosome : 1
Position de début : 1005747
Position de fin : 1005828
Voir sur JBrowse
Séquence transgene :
gcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattcca
Chromosome : 1
Position de début : 3710
Position de fin : 3771
Voir sur JBrowse

Commander