Ressources

Ressource: HAPT LUC insertion aléatoire 168

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 168

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta19g00160

Voir cette cible sur JBrowse
Lien :
Séquence début :
tcggctcgaaccattatttttcagaaaattaacacgaaaattcatgattttcgtccgaacctcgacgacgcgatactgagcgagagacgacgagcgatggctcgttggaaagctcgtaagttttcctaaaatatattctcgaatgagcgcaatcggcgcacgcgtcgcgacgctagacgcgcgcaaacacgaaaattaacatttttcatactttttaccgaaatccctt
Chromosome : 19
Position de début : 40778
Position de fin : 41006
Voir sur JBrowse
Séquence transgene :
gagttgtgacgacgccgtgcgatcgaatcgagcgtttcaccgcgcgcgccg
Chromosome : 19
Position de début : 3425
Position de fin : 3475
Voir sur JBrowse

Commander