Ressources

Ressource: HAPT LUC insertion aléatoire 156

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 156

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta18g01720

Voir cette cible sur JBrowse
Lien :
Séquence début :
tcgtcgtctcgacggcgacgaccacgcctccgtcgccgacgtctcgctcgtccgcctatcc
Chromosome : 18
Position de début : 286472
Position de fin : 286532
Voir sur JBrowse
Séquence transgene :
atgggaattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccag
Chromosome : 18
Position de début : 1
Position de fin : 97
Voir sur JBrowse

Commander