Ressources

Ressource: HAPT LUC insertion aléatoire 155

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 155

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta18g01720

Voir cette cible sur JBrowse
Lien :
Séquence début :
cgtcgtctccgtccgacgcgtgcgctcgatcaccttgatcgccacgtgctt
Chromosome : 18
Position de début : 286313
Position de fin : 286363
Voir sur JBrowse
Séquence transgene :
tcggtgagtttgaaagcagggggtcatacacgagtcattactctctattta
Chromosome : 18
Position de début : 3369
Position de fin : 3419
Voir sur JBrowse

Commander