Ressources

Ressource: HAPT LUC insertion aléatoire 151

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 151

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta15g01520

Voir cette cible sur JBrowse
Lien :
Séquence début :
ttcaactgctcatcccaaagcttcaatgtaagtcgaggatgaacgagacatttgagcacatcttcattctctatctccaagacgtcaacaattaagtgagcgatggaaaggcgttcatcgccgacacggtcaacttcatcgatgacgtccgtcctcccgcgtgtacgaatcgagcttttagattg
Chromosome : 15
Position de début : 255273
Position de fin : 255457
Voir sur JBrowse
Séquence transgene :
agcgtcgccaggccgcaagaacgtgaaatattccgagaatattaaagaatattcc
Chromosome : 15
Position de début : 135
Position de fin : 189
Voir sur JBrowse

Commander