Ressources

Ressource: HAPT LUC insertion aléatoire 150

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 150

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta15g01520

Voir cette cible sur JBrowse
Lien :
Séquence début :
ttcaactgctcatcccaaagcttcaatgtaagtcgaggatgaacgagacatttgagcacatcttcattctctatctccaagacgtcaacaattaagtgagcgatggaaaggcgttcatcgccgacacggtcaacttcatcgatgacgtccgtcctcccgcgtgtacgaatcgagcttttagattg
Chromosome : 15
Position de début : 255273
Position de fin : 255457
Voir sur JBrowse
Séquence transgene :
tcctggaaaagtatttcttaagccatgggaattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccag
Chromosome : 15
Position de début : 1
Position de fin : 121
Voir sur JBrowse

Commander