Ressources

Ressource: HAPT LUC insertion aléatoire 147

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 147

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta15g00760

Voir cette cible sur JBrowse
Lien :
Séquence début :
aatgtaccactgcgcgacttcgtccaaattcgcaccgcccgcggtgagcca
Chromosome : 15
Position de début : 129782
Position de fin : 129832
Voir sur JBrowse
Séquence transgene :
taaactagtacgcgtcttaagcgagacgggtaaagcgcgacgtgaagtaac
Chromosome : 15
Position de début : 196
Position de fin : 246
Voir sur JBrowse

Commander