Ressources

Ressource: HAPT LUC insertion aléatoire 143

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 143

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta15g01520

Voir cette cible sur JBrowse
Lien :
Séquence début :
cagataaacatacttttcggtctcacaagtcacattgaacgagacgagagg
Chromosome : 15
Position de début : 253221
Position de fin : 253271
Voir sur JBrowse
Séquence transgene :
cacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtc
Chromosome : 15
Position de début : 3834
Position de fin : 3884
Voir sur JBrowse

Commander