Ressources

Ressource: HAPT LUC insertion aléatoire 139

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 139

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta14g00070

Voir cette cible sur JBrowse
Lien :
Séquence début :
catccgtgatgcgaccaccgtagttagcttcgcctataaggtagcgtagcg
Chromosome : 14
Position de début : 23752
Position de fin : 23802
Voir sur JBrowse
Séquence transgene :
tgcggcttcttgacgccgccggtcgccggggcggacttgcgggccgccttg
Chromosome : 14
Position de début : 3554
Position de fin : 3604
Voir sur JBrowse

Commander