Ressources

Ressource: HAPT LUC insertion aléatoire 123

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 123

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta09g01940

Voir cette cible sur JBrowse
Lien :
Séquence début :
atccgcgccgttcgcgtacgtcggcatccccatcggcgccgcgctcgacaa
Chromosome : 9
Position de début : 284041
Position de fin : 284091
Voir sur JBrowse
Séquence transgene :
ggcggcgtcaagaagccgcacaggtaccgcccgggtaccgttgcgctcgt
Chromosome : 9
Position de début : 3585
Position de fin : 3634
Voir sur JBrowse

Commander