Ressources

Ressource: HAPT LUC insertion aléatoire 119

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 119

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta08g00790

Voir cette cible sur JBrowse
Lien :
Séquence début :
ttccacacgttgatgacgcaactgtgcttccgcgcgcgcatcacgtcgagc
Chromosome : 8
Position de début : 121713
Position de fin : 121763
Voir sur JBrowse
Séquence transgene :
gtcgacctcgaggccagaagactaagaggtgaaagatcccacgagcgcaa
Chromosome : 8
Position de début : 3625
Position de fin : 3674
Voir sur JBrowse

Commander