Ressources

Ressource: HAPT LUC insertion aléatoire 118

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 118

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta07g03740

Voir cette cible sur JBrowse
Lien :
Séquence début :
cccttgagcatgtcccacatcgccacgtgcgagtccgccccgcttgtcaac
Chromosome : 7
Position de début : 583851
Position de fin : 583901
Voir sur JBrowse
Séquence transgene :
gatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtc
Chromosome : 7
Position de début : 2578
Position de fin : 2628
Voir sur JBrowse

Commander