Ressources

Ressource: HAPT LUC insertion aléatoire 117

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 117

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta07g01040

Voir cette cible sur JBrowse
Lien :
Séquence début :
gcaactttgtgcggttgaagcccatcgagacgggatttacacacaagaccc
Chromosome : 7
Position de début : 137103
Position de fin : 137153
Voir sur JBrowse
Séquence transgene :
tcacacaatctttgatgcgttgattgtttctaaatggcacacaatgagtca
Chromosome : 7
Position de début : 3251
Position de fin : 3301
Voir sur JBrowse

Commander