Ressources

Ressource: Mutant insertion KANMX 56

Ressource


Nom de la ressource : Mutant insertion KANMX 56

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta19g00160

Voir cette cible sur JBrowse
Lien :
Séquence début :
ttatacatcttctgtgattgacaaatgaagtgcgtcacaccaggagatctc
Chromosome : 19
Position de début : 40497
Position de fin : 40547
Voir sur JBrowse
Séquence transgene :
gtgatttatattttttttcgcctcgacatcatctgcccagatgcgaagtta
Chromosome : 19
Position de début : 103
Position de fin : 153
Voir sur JBrowse

Commander