Ressources

Ressource: Mutant insertion KANMX 2

Ressource


Nom de la ressource : Mutant insertion KANMX 2

Génomique


Type de lignée : Insertion aléatoire
Protocole de fabrication : Mutant insertion KANMX
Antibiotique : KANMX
Cible : gene : ostta08g02970

Voir cette cible sur JBrowse
Lien :
Séquence début :
ggcgtcgtcccgcgcgcgatgtcccgtcccgtcgcgcgcgcgcgacgtcgc
Chromosome : 8
Position de début : 485374
Position de fin : 485424
Voir sur JBrowse
Séquence transgene :
tatactgctgtcgattcgatactaacgccgccatccagtgtcgaaaacgag
Chromosome : 8
Position de début : 2
Position de fin : 52
Voir sur JBrowse

Commander