Ressources

Ressource: HAPT LUC insertion aléatoire 85

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 85

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta08g01600

Voir cette cible sur JBrowse
Lien :
Séquence début :
gatcgatgccgaggagacgtcgttggggacggtcgggagcggactcggcga
Chromosome : 8
Position de début : 267681
Position de fin : 267731
Voir sur JBrowse
Séquence transgene :
tgacgacgccgtgcgatcgaatcgagcgtttcaccgcgcgcgccggtgagt
Chromosome : 8
Position de début : 3419
Position de fin : 3469
Voir sur JBrowse

Commander