Ressources

Ressource: HAPT LUC insertion aléatoire 17

Ressource


Nom de la ressource : HAPT LUC insertion aléatoire 17

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : HAPT LUC insertion aléatoire
Séquence : HAPT LUC
Cible : gene : ostta02g04200

Voir cette cible sur JBrowse
Lien :
Séquence début :
attgtgcggtgcagcggtgtaccattctaattcaatcgaagacgcgaacat
Chromosome : 2
Position de début : 849464
Position de fin : 849514
Voir sur JBrowse
Séquence transgene :
atggtattgataatcctgatatgaataaattgcagtttcatttgatgctcg
Chromosome : 2
Position de début : 2310
Position de fin : 2360
Voir sur JBrowse

Commander