Ressources

Ressource: TOC8

Ressource


Nom de la ressource : TOC8

Génomique


Type de lignée : Lignée rapportrice
Protocole de fabrication : LUC insertion aléatoire
Vecteur : PotLuc
Antibiotique : KANMX
Cible : gene : ostta13g01820

Voir cette cible sur JBrowse
Lien :
Séquence transgene :
acctcgagccgggaccaaaaagcaaaaagcgaccacggggtgtgccgagatctcaaaaac
gaatcccgcgaaataccacatttcatacatacacctacaacacacacaatatgtatcaca
catccgatcaaatatgtttatcgtgaaaatatctcaaagacgatcacttttcacccacct
cgcagctcccgtcgcggcgccggcgcgagtgctccacggacgccgcgcgcgtcgacgcgg
gcgacgcgcgatcgttcgcgagacgtcggcggtgcgattgtctcttcgctctcgtccgcg
ttcgatcgatcgagcgtccagggaggcggacgcgaggattaatccaaaccatcgtttcct
cgacgcggcgaccgggacggcacagagacgggacgggtctcgagacgcgagcgatgtccg
acgcgcgaacgcgctcgcgagggacggtggacatcgatggtgagacattgaagcgcgcgg
atcgggggcgacgggggcgtgaaagcggggatcggcggagcgagacgaacgcggtggcgg
cggcgggagaggacggcggcgagcgagacgcggacgcgctgcgagtcttgctcgccacgg
atgacgcgcacacgcgaggaatggtgcataaaatgttgagagagctcggagtggaggttg
tgatggcgacgaacgggaaagaggtcttggaagttttgcgaggaaggccgaaaggcgtgg
cggcggcggcggaggacgtttcggtggacatgattttgttggatgtgctcatgcccgctt
tggacggcgaggtcgagctcgtggaggtgtgcaagtcgaatgaagctttacgaggcgttc
ccattgttatcatgtccaccgtggacgagcggaaggcgtgcgggacgcggtacgagcatt
ccggcgccgctggtttcctgacaaagccagtgaaccgaaccgagctcaaggagagcttat
cgcacacgcgcatgctgaaaagtcacgagagtggcagcgccgagaatgatggctccggga
acgatcccaacgtcggaagcgccaagtcttcactcacaaagctcaccaacggggagaagg
cagctggcggctcgggcgacggcggttccggtggtggtggatctggacagggacagaacg
attccggaagcgataatgttcgattgtataacgaaggtaacgagaaatcgcgacgtcgcg
aggctgaggcgatggatcgatgggccagtcgagagggcggttccggagactgcggctctg
gaggatccggtcaaggcaccggaagcggtagcggttcgcacgagggctcgggttctggac
agcgagattcgaacgaaaacgaaaagtttcgagggctgagcgtgcagctcatcaaggctc
acggaggtgcgacgaccatgctcgaactgagtttgcccgaacactcgtccgagcacgtcg
tcgttcgacgatcgaactcgcgctccgcgttcaagggattccaaacctacctcaaaagtg
agaagaaggaaagttcagtgcaaatgatgagcctagatctaacgcagcaacaacaccaat
cgttttacgaggcatcctctatgatgccgccggcggattttgccagattttacgggccca
tcatgcctgcgggcatgccgccgccgccaatggatctacccttaccgccgccaccgtaca
tcgacatgaatcagtttacggctgccgcgttcacatcggcctcgatccgacctgacatga
tggattcgaccgcaaacccgttctggagcgtgttgcaaaccgcggcggatcacacgcagc
agacgagttcaagccaagccgccgagcatcgcgccgcggcgatccgacgctttttgaaaa
aacgcaaggagcgtaactttgacaagaaagtccgttacgcttcgaggcagcagctcgccg
cgtctcgtcctcgcttacgtggacaatttgtacgcaacgctgaggagacgacgactgaaa
acggctcaaacggttctgacggaaagaaatcaaatgagttcaacgcgagcgccgccaaag
gcgaagtccagggcagagaggaacaatacgtcgatcgtcacggttccaacaccggtacct
cgaacgagggctcaaaggaaggatcgcgaagctcgtctcgcgacggctccaag
Chromosome : 13
Position de début :
Position de fin :
Voir sur JBrowse

Commander