Resources

Resource: Mutant insertion KANMX 303

Resource


Resource name : Mutant insertion KANMX 303

Genomics


Type of strand: Random insertion
Manufacturing protocol: Mutant insertion KANMX
Antibiotic : KANMX
Target: gene : ostta19g00420

View this target on JBrowse
Link:
Start sequence :
tgtgtaacaagtttgtatcattggttttggccaatttagtactcagtggct
Chromosome : 19
Start position: 107939
End position: 107989
View on JBrowse
Transgene sequence :
tgaatgctggtcgctatactgctgtcgattcgatactaacgccgccatcca
Chromosome : 19
Start position: 16
End position: 66
View on JBrowse

Order