Resources

Resource: Mutant insertion KANMX 277

Resource


Resource name : Mutant insertion KANMX 277

Genomics


Type of strand: Random insertion
Manufacturing protocol: Mutant insertion KANMX
Antibiotic : KANMX
Target: gene : ostta05g04260

View this target on JBrowse
Link:
Start sequence :
gacgcgcagcgcgttcggatcggcgaaacgcgcatcgacatccacgctcgc
Chromosome : 5
Start position: 692536
End position: 692586
View on JBrowse
Transgene sequence :
gtgaatgctggtcgctatactgctgtcgattcgatactaacgccgccatcc
Chromosome : 5
Start position: 17
End position: 67
View on JBrowse

Order