Resources

Resource: Mutant insertion KANMX 252

Resource


Resource name : Mutant insertion KANMX 252

Genomics


Type of strand: Random insertion
Manufacturing protocol: Mutant insertion KANMX
Antibiotic : KANMX
Target: gene : ostta19g00420

View this target on JBrowse
Link:
Start sequence :
ctacaatggaaatagtgctagttcaaccgttagaacaaggaactgcgttcctgtgctcctactcgtcgtgatatcaccgct
Chromosome : 19
Start position: 108045
End position: 108125
View on JBrowse
Transgene sequence :
aaactgcccgtaagtccaccggtggcaaggccccgcgcaagcaactcgccaccaaggcggcccgcaagtccgc
Chromosome : 19
Start position: 1455
End position: 1527
View on JBrowse

Order