Resources

Resource: Mutant insertion KANMX 226

Resource


Resource name : Mutant insertion KANMX 226

Genomics


Type of strand: Random insertion
Manufacturing protocol: Mutant insertion KANMX
Antibiotic : KANMX
Target: gene : ostta04g01810

View this target on JBrowse
Link:
Start sequence :
atcacgcaatccgcgcctcgatagaacgagacgccgagcgactgaaaccgc
Chromosome : 4
Start position: 273634
End position: 273684
View on JBrowse
Transgene sequence :
tcatgcgtcaatcgtatgtgaatgctggtcgctatactgctgtcgattcg
Chromosome : 4
Start position: 35
End position: 84
View on JBrowse

Order