Resources

Resource: Mutant insertion KANMX 225

Resource


Resource name : Mutant insertion KANMX 225

Genomics


Type of strand: Random insertion
Manufacturing protocol: Mutant insertion KANMX
Antibiotic : KANMX
Target: gene : ostta03g05500

View this target on JBrowse
Link:
Start sequence :
gccaacgaagtcgatcgcttcaacaagatcgtgctcggtaagtaaactcgg
Chromosome : 3
Start position: 894860
End position: 894910
View on JBrowse
Transgene sequence :
taatcaaatgttagcgtgatttatattttttttcgcctcgacatcatctgc
Chromosome : 3
Start position: 118
End position: 168
View on JBrowse

Order