Resources

Resource: Mutant insertion KANMX 185

Resource


Resource name : Mutant insertion KANMX 185

Genomics


Type of strand: Random insertion
Manufacturing protocol: Mutant insertion KANMX
Antibiotic : KANMX
Target: gene : ostta04g04550

View this target on JBrowse
Link:
Start sequence :
cgacgagcaccgctggcaaaacccggcgcgaccgttgaagaccatgttgca
Chromosome : 4
Start position: 713072
End position: 713122
View on JBrowse
Transgene sequence :
ctggtcgctatactgctgtcgattcgatactaacgccgccatccagtgtcg
Chromosome : 4
Start position: 10
End position: 60
View on JBrowse

Order