Resources

Resource: Mutant insertion KANMX 182

Resource


Resource name : Mutant insertion KANMX 182

Genomics


Type of strand: Random insertion
Manufacturing protocol: Mutant insertion KANMX
Antibiotic : KANMX
Target: gene : ostta03g02330

View this target on JBrowse
Link:
Start sequence :
gcgtccaacgcgctcgagcgcaaacctttattcctagctattcgcactgtc
Chromosome : 3
Start position: 366002
End position: 366052
View on JBrowse
Transgene sequence :
cgtggatttaaaaacaatcaagtgatgcatgcacgtgaaaaatgggcattt
Chromosome : 3
Start position: 1267
End position: 1317
View on JBrowse

Order