Resources

Resource: HAPT LUC insertion aléatoire 417

Resource


Resource name : HAPT LUC insertion aléatoire 417

Genomics


Type of strand: Reporter strain
Manufacturing protocol: HAPT LUC insertion aléatoire
Sequence : HAPT LUC
Target: gene : ostta05g00810

View this target on JBrowse
Link:
Start sequence :
attactcgtattcgattgcatcaatccaaagggacgtacaagaaggctcga
Chromosome : 5
Start position: 111561
End position: 111611
View on JBrowse
Transgene sequence :
atgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctat
Chromosome : 5
Start position: 3729
End position: 3779
View on JBrowse

Order