Resources

Resource: HAPT LUC insertion aléatoire 381

Resource


Resource name : HAPT LUC insertion aléatoire 381

Genomics


Type of strand: Reporter strain
Manufacturing protocol: HAPT LUC insertion aléatoire
Sequence : HAPT LUC
Target: gene : ostta11g00160

View this target on JBrowse
Link:
Start sequence :
ctctcccagctcgtcgtcaatgattcctatgtcgtcatcgtctgagtcgtc
Chromosome : 11
Start position: 27657
End position: 27707
View on JBrowse
Transgene sequence :
ggataacaatttcacacaggaaacagctatgaccatgattacgccaagctt
Chromosome : 11
Start position: 3708
End position: 3758
View on JBrowse

Order