Resources

Resource: HAPT LUC insertion aléatoire 330

Resource


Resource name : HAPT LUC insertion aléatoire 330

Genomics


Type of strand: Reporter strain
Manufacturing protocol: HAPT LUC insertion aléatoire
Sequence : HAPT LUC
Target: gene : ostta05g04260

View this target on JBrowse
Link:
Start sequence :
gcggaatcctgctcgtagctcacatccacggcgacgcgcagcgcgttcgga
Chromosome : 5
Start position: 692504
End position: 692554
View on JBrowse
Transgene sequence :
catgcgtcaatcgtatgtgaatgctggtcgctatactgctgtcgattcgat
Chromosome : 5
Start position: 2077
End position: 2127
View on JBrowse

Order